Search Results | SCGE Toolkit

SCGE Consortium Home | About SCGE Toolkit | Contact Us | Citing the Toolkit | License

Filter By ...

Animal (5)

Cell (3)

Organoid (3)

Immortalized (1)

Immortalized Fibroblast (unspecified) (1)

Primary cells (1)

Human (5)

Mouse (6)

Transgene Reporter

tdTomato (4)

Table View
List View

11 results for search term 'AAV' in category Model System

CD4/CD8 Human Primary T cell Model System - [In Vitro] [Biological Effects] [Human] Matched Fields: category : Model System grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1 CD4/CD8 Human Primary T cell Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Ai9 mouse Model System - [In Vivo] [Delivery Systems, AAV tropism, Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice Evolving High Potency AAV Vectors for Neuromuscular Genome Editing initiative : AAV tropism deliverySystemName : AAV AAV+Focused Ultrasound vectorName : AAVrh8-ZsGreen-Cre AAVcc47-CMV-SaCas9 AAV9-CMV-SaCas9 AAV6-ZsGreen-Cre AAV4-ZsGreen-Cre vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant) experimentName : AAV Tropism project Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Human kidney organoid (stem cell-derived) Model System - [In Vitro] [Biological Effects] [Human] Matched Fields: category : Model System deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2-SaCas9 AAV2/8CMVeGFP AAV2-gRNA vectorSubtype : AAV experimentName : AAV tropism in kidney organoids cultured under flow AAV tropism in kidney organoids derived from human pluripotent stem cells. Kidney organoid derived from human female H9 ES or BJFF iPS cells Show Experiments (4) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Human kidney organoid (iPSC-derived) Model System - [In Vitro] [Biological Effects] [Human] Matched Fields: category : Model System deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV Kidney organoid derived from human male BJFF iPS cells Show Experiments (2) AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.
C57BL/6 mouse (Asokan study) Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-mCherry AAVcc47-mCherry AAVcc84-GFP AAVcc81-GFP AAV9-GFP vectorSubtype : AAV Show Experiments (2) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Ai9 mouse immortalized fibroblasts Model System - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: category : Model System vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Ai9 mouse (BCM) Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System vectorName : AAVcc47-Cre AAVcc47-SaCas9-Ai9 vectorSubtype : AAV experimentName : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Human kidney organoid (ESC-derived) Model System - [In Vitro] [Biological Effects] [Human] Matched Fields: category : Model System deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV Kidney organoid derived from human female H9 embryonic stem cells Show Experiments (1) Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids.
C57BL/6J mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System vectorName : AAV-Pcsk9 experimentName : compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV C57BL/6J WT mouse Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
HEK-293T with Ai9 transient reporter assay Model System - [In Vitro] [Delivery Systems] [Human] Matched Fields: category : Model System vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Ai9-SauSpyCas9 mouse Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System vectorSubtype : AAV Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

11 results for search term 'AAV' in category Model System

Type	Organism	Subtype	Name	Description	Source	View Associated...
Cell	Human	Primary cells	CD4/CD8 Human Primary T cell	CD4/CD8 Human Primary T cell	Key Biologicals	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Animal	Mouse		Ai9 mouse	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	The Jackson Laboratory	Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Organoid	Human		Human kidney organoid (stem cell-derived)	Kidney organoid derived from human female H9 ES or BJFF iPS cells	Morizane lab	Show Experiments (4) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Organoid	Human		Human kidney organoid (iPSC-derived)	Kidney organoid derived from human male BJFF iPS cells	Morizane lab	Show Experiments (2) AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.
Animal	Mouse		C57BL/6 mouse (Asokan study)		Unspecified	Show Experiments (2) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Cell	Mouse	Immortalized Fibroblast (unspecified)	Ai9 mouse immortalized fibroblasts	Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice		Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Animal	Mouse		Ai9 mouse (BCM)	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	Baylor College of Medicine	Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Organoid	Human		Human kidney organoid (ESC-derived)	Kidney organoid derived from human female H9 embryonic stem cells	Morizane lab	Show Experiments (1) Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids.
Animal	Mouse		C57BL/6J mouse	C57BL/6J WT mouse	The Jackson Laboratory	Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Cell	Human	Immortalized	HEK-293T with Ai9 transient reporter assay	HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Animal	Mouse		Ai9-SauSpyCas9 mouse	Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.	Baylor College of Medicine	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice